EST 1815128 is a singleton


Sequence

>1815128 (1 EST) Length=497 AAAAGTGGATTTGGAAAATATAGTCAATCACTCTTCTGATCAACGAAACACATCCGAATTAATATCAAGTGTTCATCATG AACTAAACAATTCTCTTTCACCCAACCCACAATCAAAAGTTTTATCCCTTAAAGAGTTTTCAAATGCAACCTCCACCAAT GAAAACCTTATGTCTAGATCTCAATCTCCTGTTTTTGGAAGGACTGGAGAATTAAATAAGACAAATTCAAGTCTTGCTTT AGGAGGAACAAAGTCAAAGTCTTTAGGTAACAAAGATCAAGGTAAAAGTCTACTATTCGGGACAAATGCACCAAAATATA TATCAAGTGAAAATAGTGCTGGCTTTAATTCTAATATCAATTCTGTTGTAACAGCTACTAATGTTCCCGCAAAAACTGTA TCTGATAGAGATCGTTTAGGCACAAAAAGTGATCATTTAACTCCACTTCTATGATCTCAAGCGTATTCGGACGTTGATTT AATTCGGGGACGTCAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815128: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151283385488AI067521EST209203Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:9:24 on Fri 24 Nov 117.