EST 1815143 is a singleton


Sequence

>1815143 (1 EST) Length=609 GGTTAAGCGTTTCATCATTTTTGTATGTTGAATTATGGGTATTAGGATTGTAATGAATATTTGGATGGATTTTACAACTT ACTTGTTTAACTACTTACAATCACATAAGTAGACCAATTTTTCATACCATCTAAGTTTAAAACAAAGAGTTTCGTTTAGC TTACTGAAACCAAAAATATTATTCTTATACATATTTGATGCACAATATGTCAATGTAGTAAAACATTTCTTTTTATATTG TAAATAGCATCTTTTCTTACTTAAATTATGACACATTTCAAATTTATTAACCGATATATACAAAGTTTTTTTGTCCACTG CAATCATTTCATTTATGCTTTGTTTAGATCTATTTATCATCTTTGAAATAAAATAATTCGTTGCAAAAGTCCTTCAGAAG TCTATTTCACACTGAATTTTTTATGGTTATTTCTTTACAATACAATTATATATTCACATTATTATCATTATTACTATTGT TACATACATTTATGATCATATGAATGCGATTTTGAAAAAATTGTTATTATTCCATTATATTGTATTTTTCAAAGTTTGTA AATCTCTTTTTTCTCACTTTCTTAAGGCCTTCCTTTCCTTAAGTATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815143: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151433385503AI067536EST209218Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:36:39 on Sun 19 Nov 117.