EST 1815149 is a singleton


Sequence

>1815149 (1 EST) Length=567 ATCATTATCATTCTTAATATACTGGTGGTATGTTGCACCAAAATTTACCATCATACCAGATTATGTGTAGATTGTATTAG CTTAACTCTATATCCAAGTAAGACAAAAAAAATTGTATTTTGTTCTATCTTTTATTCACATGTATCCTTTTGGTGACCAT TTACATTTTATTATTATTATTATTATTATGGTGATGGTTGATATTACAAACTTTTGTCTAATTTTGTTTTCTTCACTATG ATGAGCATAATGAAGATCTGATTGTTACCATGCATAGACTCAGAAAAGAAAGTAATTGTACTTCATTTCTCATGTACCAT ATGACATATACAAATAGTAACTACGATTCAATATAGCCATTTGAATGGAGACAAATTGTCATGTCAAAAATACTCTTGTA TTACTTATCATATTATTCAACAGGGATGGACTTATGTTAGTCAGATAAATGCATAACATATTCATCCTTTATTACCATTA ACATCAGTATCATACTGACCACTTGTGTTTGTAAGGGAAGTTAGCAGTTTTTTTCAGTTTTGTCATTCCTTTTGAGTTCA ACGTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151493385509AI067542EST209224Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:22:56 on Sun 19 Nov 117.