EST 1815152 is a singleton


Sequence

>1815152 (1 EST) Length=390 CACTATATTACCAAATACAATTTGTTATAAATAGGAAGATGTGAATCGGTTTAGGAAGAAAGGCATCGAAATGAAAAAAA CATAAACAAGAGATAACAACGATATTCTTGCTAATTAGAAAAAAAATTTATCATATTAGCGTTAATTGTAGATTTTATAT GGTCGACGATAGTTATTTTTTGAAGGTACATATGTATAATTACAATAATTTAAAGATTCACCAAATATTAAACGTATTAT AAAATGTTCTGTGAATGGTCGAGAAAATACAAAGATAGTTATTAAAATACATGCTAATAACATACAATTTATGTAGATAT CTGTTATAGTATTTGGTTTCAGTTTAGAAGACGTGTGGTTTGTAGCTAGTAGCGTTTTACCATTGGTAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151523385512AI067545EST209227Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:41:9 on Tue 21 Nov 117.