EST 1815153 is a singleton


Sequence

>1815153 (1 EST) Length=528 GGAGATTCCTAGGTCGCCAAGTGGTTATGGGTTTCGTCTGAAGAACGAACGTCCCTGCCTCATAGATCATGTTTTAACTG GGTCTAGTGCAGAAAAATCAGGGGTTAGGGCTGGCGATATATTGCTCAAAGTGAACGGTGTGAATGTGATTAATGTTACT CACGAAGAAGTTGCCTCGTTGATTTGGCGATGCCATGAAAAGTTGTTCATAGAGGTTGAGTCACAGGAATCAAAGTTTAG CCAATGCATCATTTGTCCTTTGGAATCCAGTCATCAGAATTCACACTGTATGACTAGTTCAAAACACAAAGCTTATAGTA GAACGACCTCCGTGTTTGTTTATGCAGGCTGTGTATTGGTGCCTACTGATTTTAAGTCATGTACTGAAGAACTATCAATT CTAAGGAGGAAAACTAACTCTGTAATTAATAAAATACATGTCCGTGCGATATCAATATGTCTGGTCGATATCTGTTTAGG TGTTCTCCAGGTTCTTCTTCATGACACATACACTGCCGAAATACCCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815153: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151533385513AI067546EST209228Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:26:7 on Mon 20 Nov 117.