EST 1815155 is a singleton


Sequence

>1815155 (1 EST) Length=407 ACAATATACTGTGTCGTATTACGTGACCAAATCGCCCCTGAACCAATTTGGATGAGATTGTAAAATAATAGATCATCATT AGCGTCATTTTTCTGATTATTTAAAGGGATTGGGGAAGATCCAATCTTATCCTCCTCAACGGGGTTTATATTTTCCGCTG AATTCGACTCTTTGGCTTCTATAATCGCTAATTCATTTTCTCCAGAAAGATGTGGTCTACCGAGAGTTTCTATCTTTTGG TTTTTACGGCGGCTGGTAACAGATGGTTGCCTAACAGCAATGTTCTCTGGTGGTTGGGTTGAATCGATTTCTGGACAATA TATACCCAAAAGACGAGTGACATCACGCTCCGAAAGCGATTTTTCAGATACTCGACCGATTCGACTCAGTGTTTCTGGCT TCATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815155: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151553385515AI067548EST209230Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:42:17 on Thu 23 Nov 117.