EST 1815157 is a singleton


Sequence

>1815157 (1 EST) Length=155 ATGAAAACAACCAAAAATTTATCTAATTGTAACAGTGTGCAACAAATACAACTTATTTGTATAGCCCATTAACTGGATCT AGTCATGAAGTGATGCTATTTCATCAAACCAGTTCACCATTTACTGGTCATTCAACTAGTGATTACAGTACTGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151573385517AI067550EST209232Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:39:36 on Sat 18 Nov 117.