EST 1815158 is a singleton


Sequence

>1815158 (1 EST) Length=510 GCCAGATACTTCTGAACAAATTCCGATCCAACCACACGAATAAAAGCAGCAGTAGTATGATGCGCGACTGCTTTGGCCAA CATTGTCTTCCCACAACCTGGAGGACCATACATTATAACACCTCTAGGTGGATCAATCCCAATTTGCTTGTATAATTCGA AATGAGTTAGAGGCAATTCAACAGCTTCTCTCACTTCCTGCTTCTGAATATCCATACCACCAATATCAGAGTATGATACA TCACGTTTCTCACCAGCTTGGAGCATCGTGATACTACTGTCTGCTTCTGGGGGAACGACATCAACCAAAGCATTGCTGTG TTTGTGGAGAGCGACGCTGGCACTTGGCTTCAACAGCTCGCGATCAATTGTAGATAATATTCGAACGTACTAATTCGAAC CGGTTGTGGATCCTACAATACCGGTGCTTTGATCAACAGCTTCTAGAAACTGTCCGATAACAAGCGGGACACTTTTGATC CGCTTGACATCTTCTTGTGCAAGTAAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815158: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151583385518AI067551EST209233Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:30:35 on Wed 22 Nov 117.