EST 1815164 is a singleton


Sequence

>1815164 (1 EST) Length=149 AAAAAAAAATATTTTTTCTACTAACCTTGATTACGTAATTTTCTTCAGTTGAGCCCCTTCAACGATGGCTTACGGGAATA TATAGTCAATCTCCCTCTCTCTCTCTTCGTTACCATCTCCATCATTATCAACAATATTTACCCTATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151643385524AI067557EST209239Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:52:14 on Sun 19 Nov 117.