EST 1815174 is a singleton


Sequence

>1815174 (1 EST) Length=544 GGTCGCCGATCATGTGTGTTTAAAATGGATTTTAGTAATTTGCACTGCTTTGTCGGCAAGGGTATGATTTCTACTGCCTC CTCTGCTACCATCAATACAAATACCAGTGAACAAGATTGTAAAATTGGTCAACAGCAATATCAGCAACAACAGTTGTTCC GTCAAAATACTCCTTATAATTTTAGTTCCTGGGATTGGAATGCTGTGAATATCATTAATAATAATAATAATAATAATAAT AATAATAATAATGTTAACGGGACTCAACAACCAATTTGCAAACCTTTATTTCCTGAAAACGACGTCATGAAGATGATCAA CTTTATAAAACAGGAAAATTATGCTCCTACAATGATTAATCCAGCCAGCTTCAGTCATGAAAATAATAATAAACAAAGGT TTGTACGGGAAACTCAACCATCATTGGATAAATTAATTGAAATGGGTTATCCGAATCAGCATTGCCCTTATCCTTTAGAT CATTTGCATTCACAATTTCAATTCAATCAAAGTAGATGCCCATCAACTACAACACGATATAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815174: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151743385534AI067567EST209249Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:25:28 on Wed 22 Nov 117.