EST 1815176 is a singleton


Sequence

>1815176 (1 EST) Length=477 GATAATGAGTTTCCTTAGGTCGTTAAGTAATGTGTCAAAGTTTCTGAGGCCTACTTCAAATTTATCTCAGTTTTGTTCAT CTACATTTATTAGCCAAAAGCGTGGATATGCCGTATAGGCCAAACCAGCAGCAGCTGCTGCAGCATCAACTGGACGTGTT GTCGCTGTTATTGGGGCAGTTGTGGATGTACAGTTTGACGACAATCTGCCACCTATTTTGAATGCCTTGGAAGTCAAAGG CCGTACCCCTCGTCTTATACTTGAGATCGCACAACATCTTGGTGAGAACACTGTGCGCACCATTGCTATGGACGGTACCG AAAGTCTAGTTCGCGGTCAGCAGTGTGTTGATACTGGCGGTCCTATTCGTATTCCTGTTGGTCCTGAGACCCTTGGCCGT ATCATGAACGTTATCGGAGAAACAATCGATGAGAGAGGACCCATCAAAACGAAAATGATGTCCGGTATTCACCAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151763385536AI067569EST209251Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:47:41 on Sat 25 Nov 117.