EST 1815177 is a singleton


Sequence

>1815177 (1 EST) Length=480 GGTTTCATTTGCTCCGACTACATTTACTAATAACTCAGCCACTATACCAGAATCAAGAAATACTATTGAACGTGGTTCTC TTTATCCCACCTCACCGTCTTGTGAGCCTGGTATCATTAGAACGCCTTCAGATGGACGCAGAATACCTTCAGCACATTTT ACAGATGTCACAGAAGAAGATGATGAAAATGTTGGGACACCTAGATCATGTATAGATACAAACGTTTCTGCCTATATAAC AGGAAGTGAGTCACATATAATTCGTTATCCAAGTGGCCAAATAACTACAGGGGGCGGTATCATTACTCTGTCAGGTAGTC CATCAGTACGACCTCAGCATGGTCTGTCATATCAAAATATACAACAAACAAGTGACCCAAGTTTGGGTTCAGTTCCTAAT ATTGACAGTGATCCAATATGGCCTGATTTGCCTCCAACTAATTGTGAATCTTATTAATATACACACAAATCGGTGTTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815177: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151773385537AI067570EST209252Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 18:14:19 on Fri 17 Nov 117.