EST 1815185 is a singleton


Sequence

>1815185 (1 EST) Length=398 ATTCAACACAATGATTACTTATATGCTATTGGTGGAAACAATGGAAAAGATCGTTTGAAATCCATTGAAAGATATGATCC AAAAGAAAATAAATGGGAAATAATTGGAGAAATGAGTCGAAGTAAGAGTGGATGGTCTGGTGAACCAGCATCTGGTATTT CCGATCAAGTTGAATGTTATAATGTGATCAGATTTAGAGCTTCAAGTGCATGTACACTGAAAGGTTGTGATTTGGAGAAA AAATATATAAATCCATTGTCAACCGTATCATCTCACTGTTTAGATAATTTCAATTTGGAATATAAAGGAGAAGAAGGAAA AGACCGTGATGATGACGATCGGCAATAAACTTGAATCCACATCATTACCATGAGCAACTATTTCCTAATCTATTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815185: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151853385545AI067578EST209260Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:3:26 on Fri 24 Nov 117.