EST 1815188 is a singleton


Sequence

>1815188 (1 EST) Length=431 ACAAATCAATAGTGCAAATCTCATATTAACACCTATGTATCACACCTGCCGTTGCATTTCTCGTTAAATACATGCAAAAG TTAGAAAACAGGAAAATTACATACTTGATGAGTAATAAAAGCATAGACTTGGGGACAAATAACATTGCAAAGGAATCAGT CTGTAAGTTTATTTACAAAAGACTTAAGTGAAAATTAATAATTTCCATATTTAAACAGCAAGGTAATTGTCGAGTATCCG ACATAACCACTTTCATGTAGGGCACGACGATAACATATGCGGTGATAACACCTGTTTTAAACTTCACCGCTATGACGGGG AAATTAAATATAAAACAACATATGGATAGGAAATCCACAGTAGCAACTTGAACAAAGAAACCCTCTGAAAATATACAGTT ACAGATATTATTGACGGAAGCAATACTTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815188: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151883385548AI067581EST209263Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:56:15 on Fri 17 Nov 117.