EST 1815195 is a singleton


Sequence

>1815195 (1 EST) Length=428 CCTCGAAAGAAGAAAATTCTGCTTTACAAACATGCTAAAGAAAATGAATCTAATCAAATAAACTATCAGTTAAAAGAAAG GGATAGACAAGCAAACAAACAAAAATAACAGAAAAAATGAGGTGTTTATAGAAAAGTCACATGAGAATAGTAGTTGCCAC CCTGACTTTAAGATATAAAAGCCATTTGTAATGAAATTTATCAGTAAAAAGAGTATTATGTGGTAAAAAAACAACCATCT TCTAAATTGTAATAACCTATATATATACGATAGGTTGATTAATTGCCTATTGGATGTTATGAGAAATTGATAGCTTTGCC ACAGAATGCAGAGAGACAAGATTCACGCAGAGCTTCAGACACCGTCGGATGGGCATGACAGACACGTGCAACATCTTCAG CTGAAGCACCATACTCCATAGCTAATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815195: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151953385555AI067588EST209270Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 17:40:1 on Mon 20 Nov 117.