EST 1815208 is a singleton


Sequence

>1815208 (1 EST) Length=444 GAGGTGACGAAAATTGTTTCAAAACATCGACCAAGGTATAGACAAGCACGCATTGTCTTTCCATTGCTTCTTCCAGTGTT ATTCGGTATCGCATCACTACATCCAATCGCTACTGTGCTTACTCTTCTTTTATGTTTGGTCGCATGTTTCAATGTCGTTA TTGTAGTCGCTCCACCCACTTGTCCTTTAGAAGATACCTTTTTTTTCTTCAAATCATCTGATAGCTGTGACGGGTTTCTT AGTGATACCAATGTGATCTACAAATGTTCAGTTACTACTCTTTTCTTATGGTATTTCACAATGCTTATACCTGTAAATTT GGAGAATAAGCTGCTCTATAAAGAAATAATAATGTACAATATTCTCGTTGTGGTTTGCGTACATCTTGTGCAAATTATAC GACATATACATGCACGCAGTCCTAATCATACAATCCTGTCAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815208: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152083385568AI067601EST209283Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:51:24 on Sun 19 Nov 117.