EST 1815211 is a singleton


Sequence

>1815211 (1 EST) Length=244 CAATGAAAATCATACAATTAAATAATAAATATTGTAATACTGTCTATGTTGATCCTGGTATTCGTTTACTGAACAACAGG CGGCGTGATCAGCTCTACATGCATCAAATGAGCATGTAGAACAATTTTCGTCTTAGAAATAAGGGTTTAGTTTTCTTGTA GGTACTAAAATAAAACCTAGTGTCAGAATAGATAAACATGCAAACGAAGTAGAATGAACATAAATCATTACGACGACAAG ATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815211: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152113385571AI067604EST209286Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 10:42:44 on Tue 21 Nov 117.