EST 1815223 is a singleton


Sequence

>1815223 (1 EST) Length=408 GCTTTAATCCAAGTTAGTTCATTGAAATCAAATTATAATGCACAGAATGGTAGTATTGTTCAAGCTCTTTCATATACTGC TGATAGACAACCGACAACTATTACACAACCTGATAATGTCGCCGGTGTCGGTGATCGCAATGGCGTTACACAATCACAGT TTTCACCATTAATTGAAACGAAATTGGAACCATCAATAAATAATTCTCATAGCCTTCTACAACAAAATAATCATCTTGTA ACTTCATCGAATTCCAAGCATAGTCAACCGATAATCACTTTTCTTCCATTAAATAATAATTATTTATTCAATAACTCTGG TAATACTCTTACTTCTACGGCTACTACTACAACGGCGATTACTGGTACTATTACTTCTACTATTGCTCATGAAATCGGTT CAACAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815223: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152233385583AI067616EST209298Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:48:17 on Sat 18 Nov 117.