EST 1815293 is a singleton


Sequence

>1815293 (1 EST) Length=281 GACGACACATAATCAAACGCTTATTCTTGATCAAATGAGAAATGAATTCGAATCGACAAGATCTCAGTTGAGAACTGCTC AAACTGAACTTATTCATTATAAAAAAAATGAGGAATTATTACGAGAACGCGTAGCCAACTATGAACGTGAGATTTCTGAC TTGCAGCAAGAAGTGACGCTTCTACGAACACGACATGATCAATTGCAGTCTTCTATTGCTGTAGGTCGTACGGCTGAAAA TTCATCTGAAGTGCATAATCAAATAGTTACTCTCACTGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815293: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152933385653AI067686EST209369Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:59:3 on Sun 19 Nov 117.