EST 1815296 is a singleton


Sequence

>1815296 (1 EST) Length=423 CTTTATTTCATTCCCATGTCTTTGTTTTGCTGAAACCTAATTGACTTGAAGTAGCATTATCATATTTCATCCGACCATCT ATAATTTCTGGTCTTTTTTTTCTGTCACATTTTATATGACGATTGTAGGAGAGTGAGAGAAGAAGGGTGTTGTATTTCTT ATCTTCATGGAATTATAGAAAATACGTTTTCTTTTATTTCTGGATCATTCATTAATATACTACTACTATTAATACTATGC CTTTTTTTCATGAAAACTTCCATTTTTTAGTTGAACATATTATGATGATGAAATCATACTTGGTCTTTTGCCAATTTCAC GTTTGTCCTGTTCATACTTCTTTCTTGTTTGTTTCGATTTTCCTACCTTCGTAGACCTTACATAACCATGGAAATGCTTC GAAAGTAATCTGTTAAGTGAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815296: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18152963385656AI067689EST209372Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:27:14 on Thu 23 Nov 117.