EST 1815321 is a singleton


Sequence

>1815321 (1 EST) Length=452 GCACGAGATAATTTGCAGGATACTTTTTCATATATGGTACAGTTAGAATCATATTCTGCGCCTATTCTTTTACCAAAAGA AGCCGCTAAAGAATTACAGTTTGAAGCAATAGAACTTCTGCTTGATTGGGAGTATGAATTAGAACAAGGATATTTTGATG TTACTCCTTGGAATCCTGACCCATCCCCGCCCCTATCATGGGTACCATCACAGAGAGCCAAAGGTCAATTGAAAGCATTT ATAAATTTCCTCAATTTGGATAGTCGGCCTTTGGGTAATGATTGTTCTGGATATTGTCCAACAAAACAACTAATAAAAAA GATACAAGAACAACGTCAACAAAAGTCTCAATTGTTCAAGAGTCAAGTGATAAAATCTCATCGCCTTCTTGATGATTGCC TGAATGAAATCGAAGATGTAGCGAGTCGGTTGAAGAAAATTAGTTCTTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815321: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153213385681AI067714EST209397Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:13:7 on Mon 20 Nov 117.