EST 1815336 is a singleton


Sequence

>1815336 (1 EST) Length=455 ATTCCAGTCATTGATATCCGTATTTTGGATGGTAATGATCAAGAAAATATTTGGAAAATTATAAAATCAATTTTTCCTAC TTGGTCAAAAGAGTATACAAAAGTGAAACCATTAGAAGAAGGTTTATCTAATATTGTTATTCGTTTAGATCATGATAATA AAATAGATGAACCTAAAACTATTCTTATGAGAATTCGAACAAAATTAGCAGATTTTATTGTTAACCGGTGGGATGAAATC AAACATATGTATCTACTACATGAACTTGGTGGTGAACAAAATTATATGCAGTTTTTCAAAATGGTTTAGTTTATTCATTT ATTAATGGATCAACTATAAGTGTGGATAAATTTTCAATGTCAAAGTATAGTGAATTAATAATTGAACAAGTGGCTAGATT GCATAGTTTACCAACTCGTGAAACTATGCTAACTTTATTCCCCTAGTGAGTCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815336: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153363385696AI067729EST209412Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:34:36 on Thu 23 Nov 117.