EST 1815353 is a singleton


Sequence

>1815353 (1 EST) Length=174 CAAGTAATTAACAAGATACACAAAAATAGTAACTATAATGGATTGTAACTAAGTCAAGCAGGTCACACGTACACGCAAAA GTATGCCATAACTATTCATTCGTTTTCCTTTATCGCGACACAAGGAGAAAACAACATCGAGGAACGAGGTACATAACACA CTTTTATTTTATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815353: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153533385713AI067746EST209429Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:20:30 on Wed 22 Nov 117.