EST 1815377 is a singleton


Sequence

>1815377 (1 EST) Length=407 CAGAAAAGCGTAAATCATATAACAAGCAATTTTGATTTGATAAACTAAAGTAGGAAACGTTAAAAACGAGATTTGGAAAA GCGGTATTTTTAGGAAAAAATAATACTCTATTTAAGTTGAAGTAAAAAAGAATTGTAATTTTGAGTGCAAAAAATAAGCA CAAAATTATATAATTCAATCATCTTTAGCTAATTTTATATCTTGTGAAACATATAAACTTGGTGAACATACAATATCACG ATGAATTAAACCTCTAGCTTCATCTATTTTCAGGCTTAAAATGTGATTACCGAATTGACGACATGCACCAGAAATATGAC GAATTAATTCATCCAATTGTAGTAAACTTTTAATTAATGAACCTTCTGGTATATCACATTTTGATACGGTTGCAGAAAAT GAATAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815377: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153773385737AI067770EST209454Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 20:49:38 on Sun 19 Nov 117.