EST 1815380 is a singleton


Sequence

>1815380 (1 EST) Length=471 AACTATTCAATAATTACATCACTTGAGTCTATATTATAACCATAGGTGTTGTGCAGATTATTAAATTTTATTGAGATCAC AGACTGAACTAAATTAGATAACCATTGAGAATCTGGAAGCAATAAATGATTGCTTCATAACAGGATGGAACTTCTCTGGA GTGTGTATTTAAGACCCTACCAGCAGGGATCAAACTCAGAGACTTAAGCATCGCGCGAAAACACTGAACCGGTATACAAT GGTACACAGGTCTAACTTCAATCAATCTATGATATTTAGCCATTATATTTTATTGTCTTCAGCGAGTACCTTCTTCGCAC CTTGACTGGTTGAAATCCACTGACCATGGCTTTTCATTAGAATTCAGAAAATTTTCTCTCGAAGCTAATCACCAGTGAGC CCATCAGGATCATCAGTATAAATTCTCCGGAGGTTGTTAACCTTGTACACCATTAAATCTCGGCGCACTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815380: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18153803385740AI067773EST209457Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:42:29 on Wed 22 Nov 117.