EST 1815406 is a singleton


Sequence

>1815406 (1 EST) Length=397 TGAAGCTGTGGCTTATGGTGCAGCTGTGCAGGCAGCTATTCTAAGTGGTGATAAGTGTGAGGCTGTGCAGGACTTGTTGT TGCTTGACGTAGCTCCACTATCATTGGGTCTTGAAACGGCTGGAGGTGTGATGACGGCTTTGATTAAGCGTAACACGACA ATTCCGACGAAACAGACTCAAACGTTCACGACGTACTCGGACAACCAACCTGGTGTGCTTATCCAGGTGTTCGAGGGCGA GCGTGCACTGACTAAGGACAACAATCTGCTTGGTAAGTTCGAACTATCAGGTATCCCACCTGCTCCTCGTGGTACTCCTC AGATTGACGTGACGTTTGATATACATGCGAACGGTATTCTGAACGTATCTGCTGTTGACAAGGGTACTGGGAAGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815406: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154063385766AI067799EST209483Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 20:54:36 on Sun 19 Nov 117.