EST 1815419 is a singleton


Sequence

>1815419 (1 EST) Length=419 TTTCAGTGGAAGGAACTTACTGTTGTTATGGTCTTAGTTTTGGTGGTTCTGATTGGTGTGAACTTAAATTTAAAACCTGT GAATCGGGCGAAGATCTTCCAGATGTTTTGCAACATGTCAAATTCAGTTCAATTTCGTGGACATAGGATGACAAAGGTGT TTTTTACTGTATGTACCCTCAGCATGAAGGTAAAGCAGATGGTACTGAAACAACTACTAATACTGATCAGAAGCTCATGT ACCATCGTCTGGGTACACTACAGTCAGATGATATTTTGTGCCTGCAACGACCGGATCAACCTACTTGGAATATTCAATGA GAAGTGTCTGATTGTGGGAGATACGTAATGGTAACTTTGTATGATGGATGTCAACCTAATAACCAGCTTTTCTACTGTGA TCTTGAAAAAGTCGATCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815419: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154193385779AI067812EST209496Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:20:9 on Wed 22 Nov 117.