EST 1815477 is a singleton


Sequence

>1815477 (1 EST) Length=707 AAGACTAAAAATCCCCCCTATTTTTCTCATGAATTCATTATTACAAATCATGGGGACATTGTCAGTGTTTTAGCGATGAT AATCATCGTTGGTTTGCTGCACAAGGGAACCCATGTTTTGTCTTCATCTTTCATATTCATCCAGTACAATAACACCGACG AAAACCAAGAAAATGCCTTATTATACAGCCCAGGAGCAAAAGATTTATGCGTAATATTTTTTTACACTCTTATTTGTATC GTTTCCCATGCTGTACTTCAAGAGTATCTCTTTGACAAAGTGACTCGAAAGTTGTGTTTGACAAAGGTTCGGCTAGCTAA ATTCAACGAATCTGCCCACCTTGCATGCTTTTATGCTTTGTCCACAGTTTGGGCTGTTTACAGTATTATTAACGAAGGTT TTATAGAGAATTTAAACAGTTTGTGGGATAATTATCCGCAGAGATGGCTGCCATTTTGGATCAAATTATTTTTCATCACT CAAATTTGCTACTGGCTTCATGACTATCCAGAGCTTTATTTTCAGCGTGTTAAGAATGAACTCATACCTGCACGACTGTT CCATGCAACATTATATCTTCTTAGCATATCTTTGGCATATGTTGGAGGATTAACTAAATTATGTATGGTCGTTCTTGTTC TTCACTACGGTACTGACTTCTTCTTGCACGTTTCTCGGGCGTTGCACCTTGCGGAGTACAAGTTTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815477: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154773385837AI067870EST209554Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 8:54:47 on Tue 21 Nov 117.