EST 1815490 is a singleton


Sequence

>1815490 (1 EST) Length=708 GAGGTGCCGAAATACAGTCAACTTCCAGCAAGTTATGGCCAACATAGGAATGTGGGCTGTGGTTGTTTTCGGTTGCGCCA TCTTAACTTGGTTTGATTTTTGGGGATTAAAAGGCAGCAGCAATTCAGAGAAAACCATACCAATTCTAAAAAAGCCAATA AATCCACTTCCTACACTTCAGTTCATGTTTTGCGTTTCCTGAGGGTATCGGCGGGTGTTCGAGGAGATGTCACGGATCGT CTTACAAAAGTATCCATCTTTTGTTATAGAAGGCGACACGTATCCTCCACCCGCCTGGCGAGCCCACTTGGCAAAATCCT TACAATTCCTGAAATATTCTATTATTCTTATGACTGTGTTTGGTTTCGACCTCTTTGGATATCTTGGTTACCCTACTCCT AACTTTGTCTCATATGCCATGCAAAATAAAGTTTCTTTCTGTTTGATGACCTTTCTACTTGGAAATGTTATTGAAGGACA GTTGCTATCTACGGGCGCTTTCGAAATATACTTAGATGATATCCCAGTCTGGTCGAAATTGTACACAAATCGTATCCCTC AACCAGAGGAACTTCTTCACATAATTGACAATCACGTAAAACTCCGAGATTCAACANAGACAATACAATCCGTCGGTCCA CCTCTGTAGTATTTAATGCATACAACTGGCTTTAGTTTTTTTTACCAATAAAAGCGCAAAGTCGTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1815490: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18154903385850AI067883EST209570Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:31:8 on Thu 23 Nov 117.