EST 1815520 is a singleton


Sequence

>1815520 (1 EST) Length=662 GCACGAGGACCATCCTTATCATAATTTACCAGCAATATTAACAACACGATACCTTATTGTGACAGGGTTACGGGTCTGTC TTAAGTATGGCGGAGAATCTTAGTACTATTCTTTCTGAAATCACCACTTGCAAATCACCAAAAGAAGCTACGGAAAAGTT TTCAAACTTGCTGAAATCTCTTCCTCAGTCTTCCGATAGTTTACTAGCTGATATAACTACAATTGTCAACACAATTTCTC AGGATATGGTGACAGTTATAGCGGCCAGGAAGTTTTGTGATGAACTTATAAACTTTGTGAATCAAGTTCCTGATAATTCT TTAGCGATTAGTGCATTGCAAATCCTACTTTCTCGAATGCAGTCAAGAAATATTGCTTTTGAGTCTCAATTGGTTGAACT ACGTGATTCACTTTCTAAGCGATTAGAAGCCGTAGGAAACCTTCGTGAAGCCGCTACTGTTTTGTCTGATATACCATTAG AGAGTGGACAACGAGTCTATGGAGTAAATTATAAATTGGATATCTATTTGAGAATAGCAGAATATTTCTTAAAAATTCAT GAAATTCAAGAAGCTGAAGTTTTTGTAAATCGGGCATCTTTGCTGCAACCAGAATGTCAGAATCAACAACTGTTGGTTCG ATACAAGATAACCTATGCACAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815520: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18155203385880AI067913EST209601Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:2:18 on Thu 23 Nov 117.