EST 1815549 is a singleton


Sequence

>1815549 (1 EST) Length=272 CAGACTTCTCAGTTCTGTAGGTTGACAAGGTCAAGACTGATTAGAATTCAGACTAGGGAAAAAAATAGATAAACGAACTG ATAGAAAGAGGGAAAGCGATAAGCAAAAAGCAAACAGCGTCGCTTGTCAGGATAACGTTTTGATTGGTTTTTTTCAGATG GACACTGTCATGCTATTCTCATGAGTGTTCAGCTGGTTGGAATTAAGATTAAATTTGACATTTTATCGACGAAAGCGCAA TTAATTAATAAAGGCGATAAAATAACATTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815549: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18155493385909AI067942EST209630Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:18:5 on Fri 24 Nov 117.