EST 1815586 is a singleton


Sequence

>1815586 (1 EST) Length=433 AGCATATAATAACACTATATTGCTAGAAACATGTATACAAAAGTAATGCAATTACGTATTTACAAAAATATTTTATATTC TTCTGGCCAGATGTGGTGAAAAATGGAATAGGGTAAAACATCACTTCAAACGATTTTTTAAGTAAAATAAGATCTGATTA GCTGCTTCTCGACATGTTCCACTTATCCATGCGATCTTTATCACCAATGGTCCATGGTTCTCTTCAGCAAGAATCACATC GTTATCATCTTCATCATCACTAGTGCCTATATCACTTTTAACTTTCACAATTGTCTGTCCACATTCAGTGCTATCATTAT GCATTACTTCATCACTGTTGTTGATTCCATGCGGAAATAAAGATGATTTTGCATGTACATCTTTATTAAATGAATCTGTG TTTAAATACTCAACAAATACATTGGCTTGAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815586: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18155863385946AI067979EST209668Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:17:3 on Wed 22 Nov 117.