EST 1815625 is a singleton


Sequence

>1815625 (1 EST) Length=650 GCGAAGTTCGTCTGATTTGTGCTTTTTGTTATTCTCTAACTAAACACATCAGTAATGGACTCAGCAGATAACCCTTTTGC TTCGCTTGTAAAAAATTCATCAGTCGGTCTGGGTCCGGCAATTTTTGGTGCCTGTGAAACTGAAGTTACTAAAATCTTGG AGAACATACTACTCATTACCCATGATAAAGATCTTGTTTTTGGTGAATCAGGTAGACCCAGTCATCTACTTTACATACAA CCGTTCTCGTGTGGTAATGTACATATTTCGGGGAGCAGTTTAGATGAACTTATATTTGACCGAACCCAAATGAGAAAATT TAACGATTATGATGTTGTCAGCATTAACACAGGGGCGGCCACGGATATCAATGACGTTTTGGCTTCCAACCCAATTAGTT ATTTGGTCTCTTCTTATCACCGTGCGTGTGTAATTAAACAAACAAACGCTCTTTCACAGATCGTTGAAGATTGTCGCAAA AGTATTGTAAGACAAATTGTACTTCTATTGCTTGTTGATGCTGAGTCTGATAATCCGGAAAGCAGCACGAACCTATTTGA TATCGTTTATCAAGCTCTCTGCACAGATGACTGCGATCAAATTGCTTATATTCAAAAAATGTTTGATGAAGTCCTTAGTC ATCTGGAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815625: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18156253385985AI068018EST209707Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:44:7 on Fri 24 Nov 117.