EST 1815652 is a singleton


Sequence

>1815652 (1 EST) Length=326 TTCCTGGAGGAATGGTTCGGAGTCGTTTGGATATAATGTCTATTGATATATTAGATGACTATGAGAAATCTGGTGTAAAA TCTGTCTACATAATTTGTATATTGAAAGGAGGCTTCAAATTCGCTTCCGACTTATTCAGAACATTACAAGAGTATTCATT TACACGTCGAAGTTACATCAAAGTCAGTATTGATTTCTTCGCTGCAAGTACATACGTCGATGATTCAGTGGGTCATGAGA CCAACATCACTCCGTGTACAAATATGGAGAAGTTCAGAGATAAGGATGTACTGATTGTGGAAGATATGGTTGACACTGGA ACAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815652: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18156523386012AI068045EST209734Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:41:1 on Sat 18 Nov 117.