EST 1815666 is a singleton


Sequence

>1815666 (1 EST) Length=361 GGTTTAATATTCCACCTGAGCAAATGCATAAATATCAGCAGGCGTATTATCATTATTTGCAAACTTTTTATATGGAGAAT CCTCCAATAAACCAAACTGAGTGCCATACGCAGGATTACTGTTACCCTTACTATTTTGGGACAGGGACTGTTATGCAAAT GCTTCCCGGGAACTATAATTTCCCTAACAATGCTTATGTCCCACAAACTCATAGCTCTTTACGCCAAACAACCACAAACA GTTCATCTAGCAATATGCAACAGTGGATTCAAAGGGCGCAGGCACTTTTATCCAATTGGGGAGTGTTTAATGGTAATCAG CGTCAGAGGGAAGCGGATGAGGTATTACCTAACGAAGATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815666: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18156663386026AI068059EST209748Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:30:10 on Mon 20 Nov 117.