EST 1815671 is a singleton


Sequence

>1815671 (1 EST) Length=381 TGGATCAACTGTCGAACAAGATAGTGAATTATTGGCGAATATTAGTTGTGGTAATAGTAGTACTAGTTTAGTCTTGAATT CAGAGTGCGATCATGTTATTCATAATACAACTAGTTCTGAATCGAAAGAATGCGTTTCTAACCTACTAAATCATGGTGAT CATGAAGATGATGATAATGCTGCGGATGAACATGATTATGATATTGATGGTCCCGTTGATGAGAGACTGTGTAAAGATTT AGAAGAGCGAATCACTTTTGGCAAAGAAAACTTTGAAGCCATAAAAAATAGAGAAGAAAAAATCTGTGATTGTATGAATG CTTATCGGAATCTTTCTGAAATTATTACTGATAATGGAAACAGTAGTATGAATGATATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815671: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18156713386031AI068064EST209753Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:47:53 on Sat 25 Nov 117.