EST 1815715 is a singleton


Sequence

>1815715 (1 EST) Length=134 TATTCCATGAAACCTTCTATCCAACGTTGAGTACAATCGATCCATTGGGTGGTTTATCAACTCTTGATATTCTAACTGCA ATACGAAATGCTACCGGACCAAGACCTGCTCTATTTGTGCCAGAGGTTTCTTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815715: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18157153386075AI068108EST209798Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:5:15 on Fri 17 Nov 117.