EST 1815724 is a singleton


Sequence

>1815724 (1 EST) Length=418 GCACGAGATTGTGGTTTAAACATCTGGTTTGAAGCTCAGATATGGTTTCTGTAATTGAAAGCAACGCCAGCCCAGATTCT GCATTTACAGTTGTACCAATGGAGCCATCAGACATTTTGAGTCTGGCTGGTCAGTTTGTTGTGCAATATTACACCGTCAT GAAAAAGTGTCCATCTGGAATTCATCGTTTCTATAAGGATGATTCCTCTATGATACGCGAGGATACCCCAGTATGTGGTC AAAGAATGATTCACGAAAAAATTATGAGTATGAATCTTCAGGACTCACAAATTGCTATCCTGAAGTTAGACGCCTTACGT GCCAATGGGAATAGCGTACTGATTCATGTCGCTGGTGAAATAAGTATAGTCAATGAAGAGTTCAGAAAGTTCACCCAGTG CTTTATCTTGAGGGAACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815724: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18157243386084AI068117EST209807Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 7:2:16 on Tue 21 Nov 117.