EST 1815787 is a singleton


Sequence

>1815787 (1 EST) Length=415 GGTTAGGTTAACCTGTTTAGGGATTTTGACGTATTCGACGGGTCAATGTAATGTCTGTCCCTCCCCCACCACCTCCCCCT CAGATTAAATCTACCAGACCACCACCGAAACAGGCCTGCGACTCTTCAGGTCCAGCGTTTTTGGCTGATATTAGGGCCGG CCGGACTCTTAGAAAAGTTCCAGATTCTGAAAAGAAGGATAGGAGTGCTCCTTTGGGGTCGAAACCAACAGATCAAAATA ATGAAGGCAGTGCTGCAGGTCCACCAGCACTTGTTAGTGGAAATCTCCCACCTGTTGATCTTTCAAATATTTTTGCAAAT GGTGTACCAAAATTAAAATCTGTTAGTTCAGCAGATGTTGCACGTAATAATACGGTGCAGAATTTATCCACAAAACCATC TAGTTATGGGAATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18157873386147AI068180EST209871Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:7:51 on Sun 19 Nov 117.