EST 1815801 is a singleton


Sequence

>1815801 (1 EST) Length=692 CAATGACAGACCTCTACCTCCATTATTTAATTTGACACCCTACGAAATGACTATGCGAGATGATATGTACAAATTTCTCC CACCTTCTCGAACATCCGGGGGAGGTGGGGTATCAGAGTCAAGTTTACCACCTACTTCAGATCTTTTAATGGTAGAACAA CCACAACCGCATCATATAACAGATACTGTATGTATTGATCGCACAGGACAAAATCACAATCCCTCTACATCAGAAGGGAG TAAATTATCGGATTCAGAAATTCGATTAGCGGTTATTGCTCCATCTCATAGTTCGGATAACATACGTCTCACATCAAATA ACAGTAACAACAATGATAATAGCAGCAATATTGATATACCTCAACAATTGAAAGATTCCTGCCATGAAGAGTTAGAATCC AGGAATATTCAAGGTGTCAATAGTTAAATATAATTATCTGTCCATCTATAAAATTTATTCACCATATTTGTCCTACAGTG ACATTTGTTAAATTTCAAAATTCAACATCACGAAACAAGGATGAAAAACCATTCGACTCAGGTTTCTCGTCCTGTTTATT CCTCCTGAGACAAGTACTAATTATATACATGTACAAATGTTTAACAACAAAATAATATCTCTTAAGATTAATGTAGCTCC TCCCTGTANATGACAATCATCACAACACAGAATTATAGTAAAAGTAAAGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815801: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18158013386161AI068194EST209885Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 1:59:32 on Sat 18 Nov 117.