EST 1815805 is a singleton


Sequence

>1815805 (1 EST) Length=491 GATAATTAGGTGTTCAACTGTGGTTGATTTTTTGGATGATAGATTTATTAAAAATATTAAAAGGTATAGTCAATTGTGGT AGAAAGGTAATAGGATTTATAGGGTTACCTTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTAT TATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTCCCTT GGTTTCTTAGTGTTATAGCCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTCCCTTGGTTTCTTAGTGTTATAG CCCATACTCCTTTAGTCTTTTAGTATTATCGTCTATAGTACGGTAGGTGGGTAAAAAAAAAAAAAAAAAAAAAAAAAACT CGAGGGGGGGCCCGGTACCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGAC TGGGAAAACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1815805: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18158053386165AI068198EST209889Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:18:51 on Fri 24 Nov 117.