EST 1815810 is a singleton


Sequence

>1815810 (1 EST) Length=638 GGAAGGTTACACATACGAAGTTTCCGTCTCATTGACGAAGGTGACTGGACGTGCATAGCTGGTTCAATGAATGCCACAGT CACATTAACAGCTAGAACTCCAGCAGCAGGGTTTCACGATTGGGTGCAAAGAAACAGATTATGGACCAAGGGTATGCTCA GTGATGATCCTAAGGCAATAGCTGTAAATCATGAAATTATTCAATGGGTTGTTGGACCATGGAGTACATGTTCTACAAGT TGTGGCCAAACTGGACAACAATTTCGTGTCGTCAGATGTGAAAAAGTTGATAGTCGATTCTATCAAATACTGAATGATCA AGTATGCATTGATAAACTATTGCCAAAACCACCAAGTACACGAAAGTGTTTAGAAAGTAACAAATGTCCAGCATGGTTCG TTGAAAACCGTGACACATCTGTTTGTACAGATCGGTGTTTAGATGTTGGTAAAGGTTCAATTAGTGGAAATTTAGTCTGT ATGATTGGTGAGAGAACCGTCGCCACAAAATATTGCGATAAATTAGATAAACCAAATATGGAATGTGAAAACCCTATATG TCAAGTACGATGGAACGTCAGTAATTGGTCTCAATGCTCACGTTCATGTGGTGGAGTTGGTGTTCAAGCTAGACACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1815810: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18158103386170AI068203EST209894Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:6:23 on Sun 19 Nov 117.