EST 1815850 is a singleton


Sequence

>1815850 (1 EST) Length=495 AAAAAATCTACTTGTAAGTGAGGTAATGAATTCAGAAAAGCATTTTCAGAGTAAAAACGTAACTATTAGAGTGCTATTTG AAGAAAAAAAATTATAATTCCCTTTGCTTTCATATTTTCTGTCTCCCTTCACACACACACACACACACTTTTTTTGTTCA ATGTTAATTATGTTTTTCCAGTTAAGTTTGATCTTGTTTCAATCGTTTTCATTTTATTATTGTTTAATCATACTTTCATT GTCCTATTTATTGTTGTAAAATGATTAATATTTGTATAGTTTTCTTTTATTGTTCATCTTGTTGGTTGAATGGTTCTAAA TAATTCTTTTCCCCTTTCATATTGTTATTGTTCTTATCATCGAACCTAATTATTCGAAAAAAAGGAACTTCTGAAGTTAA CCAAAAAGTCTACATTTCTACCATCGATTTCCTTCTTCTTATTCTTTGGTATAGTATATTTGTATTTAATAATAATAATA ATAATAATCGAAAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18158503386210AI068243EST209934Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 11:39:7 on Wed 22 Nov 117.