EST 1815934 is a singleton


Sequence

>1815934 (1 EST) Length=201 GCCTTAGGTATGTATTTCTCAGAAGCGCCAATTGTACTTTCAATTTCAAGATATTAATACTTTCTAATATTGTTTTTTTT TAGTTTTGTACATATGTCGATTATTAATACTTATTTAAAAGTATGATATACTTGAGCGTAATCACTTAGTTGATGATGAT ACTAAGGTTACATGAAATCATATTTTGTCGTATCGAAATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18159343386294AI068327EST210018Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 22:6:8 on Sat 18 Nov 117.