EST 1815956 is a singleton


Sequence

>1815956 (1 EST) Length=453 GGTACGCAGTACGGTAATGCAGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAAAAAGTAACT TTATAGACCAACCAATGATACATACATAATCAGTCATTATGAAGGTAATGATTTTCTCAAATTGATAATGGTCATTAATT TATACAAAATATGAAAGTAGAAAATAGCTAGATTGTAAAAAAAAATTTTCTAAAAAAGAAAAAAACAAACAAACAAAACA ACGAACAATAGAAAAGTAAGAAAAAGCAATAGCTGTTTATGTTGGTAAAAAAGAAGACAGTGATATGACGAGATTTGGTT TTTCTGGGAAACAATAACAACAATTGGTTTTTAGGAATTTATACTAGTGCATATTTGATGTGATTGTGAGCAAATACCAG ATTGTTCTTGTTGCTGAGAAACTAGAATGCATAATTTTTCTTGGGAATCATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1815956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18159563386316AI068349EST210040Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:25:23 on Fri 24 Nov 117.