EST 1824299 is a singleton


Sequence

>1824299 (1 EST) Length=410 ATAAGGGTTAGCAAACAACACAAAACAAAATAAAGATACAAAAAAAAAAAATCAAACAGAGAGAAATATACGTTACGTTA CAATTATTTATATTTCACTTGTTTATGTTCCCCTTTTCTTTTTTACGCATTTACGTACGGACAGTCGGGGATGCTGGGGG CGTTGGATCACACCACCACCGATGCCCTTCACAGCTTCCACGATGCGCTACAGCGGGCGCAACAGGCACTCCAGCAGGAG GAATTGCGCCTTGCCCAACTCACACAGACAGTTCGTCAGCAACAGGAGAGCAACCAGTCCAGACGCGACGCGATCCGAAG TCAACAGCAACCGCGCCTGGAGGCACTTCGACGGGAGATCATGCGGGTCCGCTCTCTTTTGGAACGACAGAAGGAAGAGG TGGAGGCACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824299: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18242993392537AI069562TENU2603T. cruzi epimastigote normalized cDNA Library


Date: 4:38:14 on Wed 22 Nov 117.