EST 1824300 is a singleton


Sequence

>1824300 (1 EST) Length=385 TCAATAATTTGCTGCGCCACAAACTCGACAAAGCCATGGGCAGAGGGTGAAGCGGATGGCGACGAGAAGTATATGAACCT GCAGGGTCCAGGTGTTCGGAATTTAACAGGATCTGTTAACGACAAACGTATCTGTGTCCCTCAAAAGATTGATCCTAAAA CATTTTTTGCAAACGAGCGAACGTTTCTCAAGTGGCTATCTATTTCTGTTATGATTGGCCTGATGTCTTTGACACTGTTG AACTTTGGTGACACGTCGAGTACTGCCCCAGAATTAGCTGGTTTGGTTTTATTACCTGTATCTATTATCTTTATGGCATA CTCTTTGTTTATTTTCAGGGATCGTGCCAATAAGATATATATGCGAGAACCAATGCGATACGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1824300: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243003392538AI069563TENU2604T. cruzi epimastigote normalized cDNA Library


Date: 4:42:9 on Wed 22 Nov 117.