EST 1824305 is a singleton


Sequence

>1824305 (1 EST) Length=272 TGGTGGTGGTGATGGGGATGAGGAAGAGCCACGAGACGATGTGGAGCTCATCTTGCAGCAGAGGCGAGACAAGGAGCAGC AGGAGGCGGCGCTACGGCAAGGAACCTGAAGGAGATTCAACAACGCGTGGAATGTAGCAGGAGCCTTCACGCCTTGGCAA AGACGATCAAGCGGCAGAATGAGGGTCTGCGGAAAAGCCTGGAGCAAAAGCGTGAGTCCCGGTTCAAACAAAAGCCGCAC GTCGCGCTCGCTGAGTGTGAAGGTGGAGTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1824305: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243053392543AI069568TENU2610T. cruzi epimastigote normalized cDNA Library


Date: 6:58:8 on Mon 20 Nov 117.