EST 1824316 is a singleton


Sequence

>1824316 (1 EST) Length=172 ATGAGGAGCAATCGCCGCAGAATGGTGAAGATGAACAGAATTTTGTTATTGTTGCCGCCGATCACGATGCCGATGTGGAG TTTGACGGTGCTGCCTCTAAACGCCGTCTCCTCGAGAGTCCTGCGCGTGATTCAACGGATTTGAAAAGTGGTGGTGCGGC CATGAATGCGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1824316: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243163392554AI069579TENU2639T. cruzi epimastigote normalized cDNA Library


Date: 3:51:20 on Sat 18 Nov 117.