EST 1824325 is a singleton


Sequence

>1824325 (1 EST) Length=407 GAAGGGCTCTTGAGGCAGTTCTGAAGCGTAATCCTCCTGCCGATGAGAAATGGGTGTTTTTGTCAAGCCGGGATGCAGAC CTCACATCGATGGAAGCAACGAAGGCAGTTTTTGAGAAATATCGACCCGATCTTGTCATTCATTTGGCGGCGAAGGTTGG TGGCCTATTCAAGAACATGAGACAACCTGTAGAGATGTGGCATGAAAACGTTGCCATTAATAATAATGTTCTTCAGTGTT GCCGCATATATGGAGTCAAGAAGATGGTCTCGTGTCTCTCAACCTGCATTTTCCCCGACAAAACGACATACCCTATTAAC GAGAATATGCTACACGATGGACCGCCGCATTGTTCGAATGAGGCTTATTCCTATGCGAACGTATGATGGATGTTATGAAC CGTGCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1824325: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18243253392563AI069588TENU2648T. cruzi epimastigote normalized cDNA Library


Date: 0:33:40 on Sat 25 Nov 117.